space
Strinct CpG site check
space
QUMA (QUantification tool for Methylation Analysis) top spacer close
When this option is selected, QUMA will check CpG site of bisulfite sequence even if reference genome sequence at the site is 'CG'. This option is mainly used for bisulfite analysis of repetitive sequence.
Because repetitive sequences are divergent, CpG site of the reference genome is not CpG site at some of repetitive sequences. When this option is selected, QUMA checks each CpG site of bisulfite sequences.
In example indicated below, 10th base is G or A at each of bisulfite sequences. When the option is selected, a methylation status of the site is judged if the 10th base of bisulfite sequence is G.
            1       10
Genomic     ATGCAATTCGCCTCGAACAT
Bisulfite1  ATGTAATTTGTTTCGAATAT
Bisulfite2  ATGTAATTTATTTCGAATAT
Bisulfite3  ATGTAATTTATTTCGAATAT
Bisulfite4  ATGTAATTCGTTTCGAATAT
Bisulfite5  ATGTAATTTATTTTGAATAT
Bisulfite6  ATGTAATTTGTTTTGAATAT
Bisulfite7  ATGTAATTCGTTTTGAATAT
Without option
CpG check default
With option
CpG check option
Due to the error-prone nature of the bisulfite chemical reaction and subsequent PCR amplification, a sequence quality of the bisulfite sequence is obviously lower than the reference genomic sequence. Therefore, QUMA is taking the standpoint of trusting the reference genomic sequence. Then, at default, QUMA judges CpG sites only from the reference genomic sequence. A more correct result will be obtained for bisulfite analysis of single-copy locus without this option.
QUMA (QUantification tool for Methylation Analysis) top spacer close